-
Seawater carbonate chemistry and the production of DMSP and DMS in the cultur...
Ocean acidification and global warming might affect the production of dimethylsulfoniopropionate (DMSP), dimethylsulfide (DMS), and dissolved acrylic acid (AAd) by marine... -
Phytoplankton abundance measured on water bottle samples during POLARSTERN cr...
This dataset has no description
-
Semi-quantitative microplankton analysis (Sylt Roads Time Series) in the Wadd...
0 = not present / 1 = present -
Semi-quantitative microplankton analysis (Sylt Roads Time Series) in the Wadd...
0 = not present / 1 = present -
Semi-quantitative microplankton analysis (Sylt Roads Time Series) in the Wadd...
0 = not present / 1 = present -
Semi-quantitative microplankton analysis (Sylt Roads Time Series) in the Wadd...
0 = not present / 1 = present -
Semi-quantitative microplankton analysis (Sylt Roads Time Series) in the Wadd...
0 = not present / 1 = present -
Phytoplankton abundance measured on water bottle samples during Akademik Fedo...
This dataset has no description
-
Abundance of microplankton in the eastern Mediterranean Sea in March and Apri...
The dataset is based on samples taken from 12 stations in Southern Aegean Sea, Northern Aegean Sea, Ionian Sea and Libyan Sea during March-April 2008. 12 Niskin bottles (8lt)... -
Abundance of microplankton in the eastern Mediterranean Sea in April 2008 dur...
The dataset is based on samples taken from 12 stations in Northern Aegean Sea, Southern Aegean Sea, Ionian Sea and Libyan Sea during August-September 2008. 12 Niskin bottles... -
Adapter-ligated sequencing libraries of total cellular Amphidinium carterae RNA
MiSeq sequencing libraries of total cellular RNA harvested from Amphidinium carterae CCMP1314, ligated to a custom GCUGAUGGCGAUGAGCACUGGGUUGCAA RNA adapter, and converted into... -
De novo transcriptome of the cosmopolitan dinoflagellate Amphidinium carterae...
Dinoflagellates are phytoplanktonic organisms found in both freshwater and marine habitats. They are often studied because related to harmful algal blooms responsible for... -
Abundant mRNA m1A modification in dinoflagellates: a new layer of gene regula...
Dinoflagellates, a class of unicellular eukaryotic phytoplankton, exhibit minimal transcriptional regulation, representing a unique model for exploring gene expression. The... -
Dinoflagellate Tree of Life
Whole transcriptomes from AToL: An Integrated Approach to the Phylogeny of Dinoflagellates -
Integrated genomic and transcriptomic analysis of Amphidinium carterae plastid
Genomic analysis of A. carterae minicircle genome -
Characterization of the enzyme for 5-hydroxymethyluridine production and its ...
Dinoflagellate chromosomes are extraordinary, as their organization is independent of architectural nucleosomes unlike typical eukaryotes and shows a cholesteric liquid crystal... -
Nickel toxicity to the dinoflagellate Amphidinium carterae, the coccolithopho...
In laboratory culture experiments, phytoplankton species were exposed to a range of nickel concentrations at GEOMAR Helmholtz Centre for Ocean Research Kiel. The experiments...
