Adapter-ligated sequencing libraries of total cellular Amphidinium carterae RNA

MiSeq sequencing libraries of total cellular RNA harvested from Amphidinium carterae CCMP1314, ligated to a custom GCUGAUGGCGAUGAGCACUGGGUUGCAA RNA adapter, and converted into double-stranded cDNA using a Maxima H Minus double stranded cDNA synthesis kit.</p><p>The aim of this project was to identify the positions and orientations of A. carterae mRNA termini, specifically those of the chloroplast. These positions can be identified by the presence of adapter ligation sites, and the orientation of the adapter (or its complement) relative to the coding sequences of colocalised genes.

Identifier
Source https://data.blue-cloud.org/search-details?step=~0122BB344B37177FBE778001AC26A48AE895480A1EF
Metadata Access https://data.blue-cloud.org/api/collections/2BB344B37177FBE778001AC26A48AE895480A1EF
Provenance
Instrument 532; 308
Publisher Blue-Cloud Data Discovery & Access service; ELIXIR-ENA
Publication Year 2025
OpenAccess true
Contact blue-cloud-support(at)maris.nl
Representation
Discipline Marine Science
Temporal Point 1954-01-09T00:00:00Z