The uptake of novel Symbiodiniaceae strains in Sorites orbiculus was measured using qPCR. To facilitate novel algae uptake, the specimens were bleached for 27 days with 0.19 mmol L-1 menthol and 5 µmol L-1 DCMU, followed by 19 days of re-inoculation with the Symbiodinium microadriaticum (strains KB8 and CCMP2467) and Fugacium kawagutii (strain F2) individually and collectively at a concentration of 1e5 cells ml-1 and a further observation for 37 days to verify long-term establishment of symbiosis. The primer pairs S.S.ITS2F (5′- TTCTGCTGCTCTTGTTATCAGG− 3′) and S.S.ITS2R (5′- ACACACATGAGCTTTTGTTTCG− 3′) were used and qPCR measurements were performed before the start of the experiment, after the bleaching experiment and after the symbiosis stability evaluation.

Symbiodinium microadriaticum, strain CCMP2467: collected in the Gulf of Aquaba on 2004-07-30, symbiont isolated from Stylophora pistillataSymbiodinium microadriaticum, strain KB8: collected in Hawaii, symbiont isolated from Cassiopaia xamanchaFugacium kawagutii, strain F2: collected in Jamaica, Caribbean, symbiont isolated from Meandrina meandritesASW: artificial seawater