-
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Viridans_Streptococci___A_genera_l__approach_to_surveillance
A collection of Viridans isolates covering 24 taxonomically designated species, including Type strains, all those analysed previously using MLSA, those strains utilized for sera... -
Assorted bacteria with public health implications
Bacteria with public health implications due to virulence or antimicrobial resistance. Many of these bacteria were associated with outbreaks or have abnormal characteristics.... -
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to... -
Bloodstream_surveillence_across_Africas
A survey across centres in Africa into the main bacterial causes of bloodstream infections. These data are part of a pre-publication release. For information on the proper use... -
Genomic_and_bacterial_blueprint_of_the_human_gastrointestinal_microbiota
Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This...