7 datasets found

Here we present a comprehensive collection of 737 whole-genome sequenced bacterial isolates from humans to understand the blueprint of human gastrointestinal microbiota. This...

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

A collection of Viridans isolates covering 24 taxonomically designated species, including Type strains, all those analysed previously using MLSA, those strains utilized for sera...

Bacteria with public health implications due to virulence or antimicrobial resistance. Many of these bacteria were associated with outbreaks or have abnormal characteristics....

<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to...

A survey across centres in Africa into the main bacterial causes of bloodstream infections. These data are part of a pre-publication release. For information on the proper use...