Dataset - B2FIND

FDA-ARGOS is a database with public quality-controlled reference genomes for ...

Data in this project is grouped by category: <a href="https://data.argosdb.org/actinomycetes/">Actinomycetes</a>, <a...
Microorganisms isolated from sludge and swine feces for deodorization Genome ...

Microorganisms isolated from sludge and swine feces for deodorization during swine manure storage
16S rDNA Sanger sequencing of LAB isolates

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

You can also access this registry using the API (see API Docs).

3 datasets found