-
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
Data in this project is grouped by category: <a href="https://data.argosdb.org/actinomycetes/">Actinomycetes</a>, <a... -
Gut Microbiota, Glucose, Lipid, and Water-Electrolyte Metabolism in Children ...
There is evidence that nonalcoholic fatty liver disease (NAFLD) is affected by gut microbiota, glucose,and lipid.However,the function of water-electrolyte metabolism remains... -
Inducible CRISPRi/dCas9 platforms in Lactococcus lactis; application in essen...
Plasmid- and genome-based inducible CRISPRi systems were developed for Lactococcus lactis. The nisin-inducible promoter PnisA was used to drive the expression of dCas9 from... -
16S rDNA sequencing
The object of this study is to explore the association between maternal gut microbiota and risk of congenital heart disease in offspring, as well as the possible mechanisms... -
Vet-LIRN-Other-GU
Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria -
Reliability of species detection in 16S microbiome analysis
The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
