Dataset - B2FIND

FDA-ARGOS is a database with public quality-controlled reference genomes for ...

Data in this project is grouped by category: <a href="https://data.argosdb.org/actinomycetes/">Actinomycetes</a>, <a...
Vet-LIRN-Other-GU

Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria
16S rDNA Sanger sequencing of LAB isolates

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

You can also access this registry using the API (see API Docs).

3 datasets found