-
SC PHL pathogens isolated from wastewater samples that are not routine Genome...
Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms. -
Pathogenic microorganism Genome sequencing
Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines. -
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
Data in this project is grouped by category: <a href="https://data.test.argosdb.org/actinomycetes/">Actinomycetes</a>, <a... -
Tracking_the_dynamics_of_AMR_genes_within_enteric_bacterial_communities_in_pi...
The aim of the proposed research is to define the nature and frequency of transfer of antimicrobial resistance (AMR) genes between pathogenic and commensal bacteria within their... -
Generation_of_draft_genomes_for_supershedder_and_bacteriotherapy_bacteria
http://www.sanger.ac.uk/resources/downloads/bacteria/ This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
