14 datasets found

Enterococcus faecium WGS

Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms.

Draft and complete genome sequences of foodborne bacterial pathogens collected for research purposes at the FDA's Center for Food Safety and Applied Nutrition.

Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines.

Data in this project is grouped by category: <a href="https://data.test.argosdb.org/actinomycetes/">Actinomycetes</a>, <a...

The study describes a workflow to encourage the clinical utility and potential of next generation sequencing for the simultaneous detection of bacteria, fungi and antimicrobial...

Use selective bacterial culture to understand the identity, prevalence, persistence, and transmission of bacteria contaminating hospital intensive care unit surfaces in two...

Culturable bacterial community associated with marine sponge Aplysina

The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and...

Whole genome sequencing of pure cultured microbial isolates of multiple species as part of the Food and Drug Administration surveillance effort of pathogens in medical products.

We determined the first complete nucleotide sequence and analysis conjugal plasmid pEF-D, an Enterococcus faecium JH5687 plasmid encoding VanD1-type D-Alanine-D-Lactate ligase.

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

The fever of patients after allogeneic hematopoietic stem cell transplantation (allo-HSCT) is complex, and it is still challenging to identify the cause of the fever. The immune...

Complete genome sequences of organisms are the foundation of understanding biological functions. High-throughput parallel sequencing technologies such as Illumina make the...