10 datasets found

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

Complete genome sequences of organisms are the foundation of understanding biological functions. High-throughput parallel sequencing technologies such as Illumina make the...

Enterococcus faecium WGS

Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms.

Draft and complete genome sequences of foodborne bacterial pathogens collected for research purposes at the FDA's Center for Food Safety and Applied Nutrition.

Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines.

<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to...

The study describes a workflow to encourage the clinical utility and potential of next generation sequencing for the simultaneous detection of bacteria, fungi and antimicrobial...

The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and...

We determined the first complete nucleotide sequence and analysis conjugal plasmid pEF-D, an Enterococcus faecium JH5687 plasmid encoding VanD1-type D-Alanine-D-Lactate ligase.