-
SC PHL pathogens isolated from wastewater samples that are not routine Genome...
Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms. -
Pathogenic microorganism Genome sequencing
Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines. -
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
Data in this project is grouped by category: <a href="https://data.test.argosdb.org/actinomycetes/">Actinomycetes</a>, <a... -
NIHR_Global_Health_Research_Unit_on_Genomic_Surveillance_of_Antimicrobial_Res...
This project is funded by the UK National Institute for Health Research to set up a full-fledged Global Health Research Unit (GHRU) through a grant awarded to the cGPS (Centre... -
An integrated method for targeted Oxford Nanopore sequencing and automated bi...
The study describes a workflow to encourage the clinical utility and potential of next generation sequencing for the simultaneous detection of bacteria, fungi and antimicrobial... -
Tracking_the_dynamics_of_AMR_genes_within_enteric_bacterial_communities_in_pi...
The aim of the proposed research is to define the nature and frequency of transfer of antimicrobial resistance (AMR) genes between pathogenic and commensal bacteria within their... -
CVM NARMS Retail Seafood Isolates
Whole genome sequencing of foodborne pathogens isolated from retail seafood as part of the US Food and Drug Administration surveillance project for NARMS -
Human microbiome associated bacterial genomes
This project is designed to uncover antimicrobial drug leads from human symbionts. -
Crop Bioprotection in collaboration with NRRL Raw sequence reads
Genome sequencing of Bacillus isolates. -
Vet-LIRN-Other-GU
Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria -
Major food bacterial pathogens in the united states and around the world, inc...
University of California at Davis 100K Pathogen Genome Project. Major bacterial pathogens in the United States and around the world, including Salmonella enterica, E. coli,... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Data set for the article: Lipid droplets support Enterococcus faecalis intrac...
Enterococcus faecalis is an opportunistic pathogen. Similarly, to other pathogens that have been historically regarded as exclusively extracellular, E. faecalis has the ability... -
Microbiological parameters and biochemical oxygen demand (BOD) off Sechura Ba...
This dataset has no description
-
Microbiological parameters and biochemical oxygen demand (BOD) on shore in Ja...
This dataset has no description
