22 datasets found

Keywords: Enterococcus faecium

Filter Results

  • 16S rDNA Sanger sequencing of LAB isolates

    Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

  • NGS in HSCT

    The fever of patients after allogeneic hematopoietic stem cell transplantation (allo-HSCT) is complex, and it is still challenging to identify the cause of the fever. The immune...
You can also access this registry using the API (see API Docs).