-
NGS in HSCT
The fever of patients after allogeneic hematopoietic stem cell transplantation (allo-HSCT) is complex, and it is still challenging to identify the cause of the fever. The immune... -
Pakistan and United States ICU transmission dynamics
Use selective bacterial culture to understand the identity, prevalence, persistence, and transmission of bacteria contaminating hospital intensive care unit surfaces in two... -
Sponge-associated bacteria
Culturable bacterial community associated with marine sponge Aplysina -
Clinical evaluation of mNGS in unbiased pathogens diagnosis of UTIs
Advance the implementation of mNGS in pathogen diagnosis in clinics. -
Bacteria and yeast pathogens sequenced from human blood culture specimens
Bloodstream infection is a major cause of morbidity and mortality worldwide. Early pathogen detection and administration of appropriate antimicrobial therapy substantially... -
Reliability of species detection in 16S microbiome analysis
The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and... -
Enhanced detection system for hospital associated transmission (EDS-HAT)
Whole genome sequencing of bacterial pathogens is combined with machine learning and data mining of the electronic medical record to enhance outbreak detection in hospitals and... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Metagenomic next-generation sequence data of Suspected Infected Pancreatic Ne...
42 blood samples and 22 peri-pancreatic specimens from 42 suspected infected pancreatic necrosis patients were collected to investigate the diagnostic performance of metagenomic... -
Evaluation of De novo assembly of bacterial genomes with rapid MinION sequenc...
Complete genome sequences of organisms are the foundation of understanding biological functions. High-throughput parallel sequencing technologies such as Illumina make the... -
Enterococcus faecium Genome sequencing and assembly
During the last 2 decades, VRE</p><p>have become significant nosocomial pathogens worldwide,</p><p>mainly due to their adaptability in hospital... -
SC PHL pathogens isolated from wastewater samples that are not routine Genome...
Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms. -
FDA-CFSAN: microbial foodborne pathogen research
Draft and complete genome sequences of foodborne bacterial pathogens collected for research purposes at the FDA's Center for Food Safety and Applied Nutrition. -
Pathogenic microorganism Genome sequencing
Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines. -
FDA-ARGOS is a database with public quality-controlled reference genomes for ...
<b>FDA-ARGOS project update</b> <p>FDA-ARGOS database updates may help researchers rapidly validate diagnostic tests and use qualified genetic sequences to... -
Endotracheal aspirate Raw sequence reads
Rapid detection of pathogens and antimicrobial resistance genes in ventilator-associated pneumonia in ICU by metagenomic nanopores sequencing -
An integrated method for targeted Oxford Nanopore sequencing and automated bi...
The study describes a workflow to encourage the clinical utility and potential of next generation sequencing for the simultaneous detection of bacteria, fungi and antimicrobial...