47 datasets found

Sequencing of several clinical isolates of different species

CDC’s Division of Healthcare Quality Promotion’s BioProject for whole genome sequence data of Enterococcus spp. We have implemented a standard scheme for isolate/sample...

Challenges in cultivating microorganisms have limited the phylogenetic diversity of currently available microbial genomes. This is being addressed by advances in sequencing...

This is a large scale project with the sequencing co-funded by collaborators at the University of Cape Town and WT Core (I2818). This is a project aimed at deepening our...

The Two Weeks in the World research project has resulted in a dataset of 3100 clinically relevant bacterial genomes with pertaining metadata, collected from 59 diagnostic units...

WGS sequencing of various bacterial isolates which were collected from mouse stool and clinical human colon samples.

Background: Three Enterococcus isolates obtained from retail chicken isolates collected in 2010-2011 as part of the Colombian Integrated Program for Antimicrobial Resistance...

The genomic dataset consists of 373 bacterial strains spanning 3 phyla (172 Actinomycetota, 6 Bacillota and 195 Pseudomonadota), 17 genera and 47 species, isolated from French...

Whole genome sequencing of bacterial isolates over a 1-year period from a hospital's intensive care units.

Pathogenic bacteria encounter a variety of stressful host environments during infection. Their responses to meet these challenges protect them from deadly damages and aid in...

Collection of 3,087 bacterial metagenome-assembled genomes (MAGs) recovered from metagenomes available from the Sequence Read Archive. These MAGs comprise part of the data set...

The aim of the proposed research is to define the nature and frequency of transfer of antimicrobial resistance (AMR) genes between pathogenic and commensal bacteria within their...

Whole genome sequencing of foodborne pathogens isolated from retail seafood as part of the US Food and Drug Administration surveillance project for NARMS

This project is designed to uncover antimicrobial drug leads from human symbionts.

Genome sequencing of Bacillus isolates.

Veterinary Pathogens sequenced as part of the effort to Combat Antibiotic Resistant Bacteria

University of California at Davis 100K Pathogen Genome Project. Major bacterial pathogens in the United States and around the world, including Salmonella enterica, E. coli,...

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

Whole genome sequencing of wastewater isolates that do not fall into GenomeTrakr enteric or ESKAPE organisms.