-
Benthic foraminifera counts from samples of the Fiji region
This dataset has no description
-
Benthic foraminifera counts from samples of the Solomon Islands region
This dataset has no description
-
Abundance of dead benthic foraminifera in sediment core CD86_08_BC5
This dataset has no description
-
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
