-
Pig lactic acid bacteria
Target of the study is intestinal bacteria isolated from domestic pigs, wild boars, domesticated Red river hogs, wild red river hogs, domesticated warthogs,wild warthogs. WGS of... -
WGS of bacteria used in a diverse Mock
A total of 227 genomes were sequenced using Illumina HiSeq 4000, as will serve as a baseline for benchmarking various metagenomics tools. In addition, 61 other genomes used for... -
16S rDNA sequencing
The object of this study is to explore the association between maternal gut microbiota and risk of congenital heart disease in offspring, as well as the possible mechanisms... -
Reliability of species detection in 16S microbiome analysis
The use of NGS-based testing of the bacterial microbiota is often impeded by inconsistent or non-reproducible results, especially when applying different analysis pipelines and... -
Generation_of_draft_genomes_for_supershedder_and_bacteriotherapy_bacteria
http://www.sanger.ac.uk/resources/downloads/bacteria/ This data is part of a pre-publication release. For information on the proper use of pre-publication data shared by the... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
RNA degradation analysis reveals ribosome dynamics in complex microbiome samples
The microbiome has revealed itself as a key player in health and disease. To better understand its role, in addition to microbial diversity, it is important to understand...
