-
Taxonomy and functional diversity of bacterial communities in lake under the ...
Studies on the structure and function of microbial communities spatial and temporal distribution characteristic in lakes around man-made forests are limited. Here, we used NGS... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
