2 datasets found

Keywords: Lactiplantibacillus plantarum subsp plantarum

Filter Results

  • WGS of bacteria used in a diverse Mock

    A total of 227 genomes were sequenced using Illumina HiSeq 4000, as will serve as a baseline for benchmarking various metagenomics tools. In addition, 61 other genomes used for...

  • 16S rDNA Sanger sequencing of LAB isolates

    Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).
You can also access this registry using the API (see API Docs).