-
Replication Data for: Microbial Biotransformation of Agro-Industrial Fibre-Ri...
Includes the experimental results of the microbial transformation through submerged fermentation with bacteria, of agro-industrial fibre-rich by-products, for the production of... -
WGS of bacteria used in a diverse Mock
A total of 227 genomes were sequenced using Illumina HiSeq 4000, as will serve as a baseline for benchmarking various metagenomics tools. In addition, 61 other genomes used for... -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Intestinal Selective Pressure and Coevolution Project Part 1 Resequencing
Systematic evaluation of the genetic stability and safety of probiotics in the gastrointestinal tract is crucial yet underexplored and challenging. In this study, we used... -
RNA degradation analysis reveals ribosome dynamics in complex microbiome samples
The microbiome has revealed itself as a key player in health and disease. To better understand its role, in addition to microbial diversity, it is important to understand...
