3 datasets found

Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’).

For infants with weakened immune systems, formula milk and complementary foods are the primary sources of nutrition. However, the presence of various potential pathogenic...

Genome sequencing of bacteria from State collection of pathogenic microorganisms Obolensk. Collection includes bacteria, fungi, and cell-lines.