-
Benthic foraminiferal assemblage (Rose Bengal stained) in MUC OB10-K, turbidi...
Core depth = depth top -
Benthic foraminiferal assemblage (dead) in MUC OB10-K, size fraction 63-150 µm
This dataset has no description
-
Benthic foraminiferal assemblage (dead) in MUC OB10-K, size fraction >150 µm
This dataset has no description
-
Benthic foraminifera analysis of sediment core Amvr13 from Amvrakikos Gulf, W...
This dataset has no description
-
Foraminifera and ostracods profile from sediment core AV14_K2-3
Determinations by Joachim Alefs -
16S rDNA Sanger sequencing of LAB isolates
Genomic DNA of isolates were extracted and 16S rDNA genes were amplified with universal primers (27F: 5’ AGAG-TTTGATCCTGGCTCAG 3’ 1492R: 5’ AAGGAGGTGATCCAGCCGCA 3’). -
Foraminifera analysis from the Trunvel and Kerallé valleys, Brittany, North-W...
This dataset contains foraminiferal assemblages from sediment cores collected in the Trunvel and Kerallé valleys, Brittany, North-West France. These analyses were carried out as...
